Review




Structured Review

PrimerDesign Inc ncbi online primer design tool
Ncbi Online Primer Design Tool, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+online+primer+design+tool/ncbi+primer+design+tool/10__3390_slash_ijms26072978-303-11-13
Average 90 stars, based on 1 article reviews
ncbi online primer design tool - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

other:

Article Title: The pathogenicity and regulatory function of temperature-sensitive proteins PscTSP in Pseudofabraea citricarpa under high temperature stress.
Article Snippet: Citrus fruit rich in beneficial health-promoting nutrients used for functional foods or dietary supplements production.. However, its quality and yield were damaged by citrus target spot.. Citrus target spot is a low-temperature fungal disease caused by Pseudofabraea citricarpa, resulting in citrus production reductions and economic losses.

Article Title: Exercise Improves the Cytoskeletal and Metabolic Functions of Brown Adipocytes Through the ADRβ3/COX2-Ywhah Axis
Article Snippet: The Ywhah primers were designed and validated for specificity using the NCBI online Primer Design Tool (Forward primer: TGGAAACTGACACAGCGACA; Reverse primer: GGCTGCTGAAAGCTCACAAG).



Similar Products

90
PrimerDesign Inc ncbi online primer design tool
Ncbi Online Primer Design Tool, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+online+primer+design+tool/ncbi+primer+design+tool/10__3390_slash_ijms26072978-303-11-13
Average 90 stars, based on 1 article reviews
ncbi online primer design tool - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Biotechnology Information ncbi primer blast online designing tool
Ncbi Primer Blast Online Designing Tool, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+online+primer+design+tool/ncbi+primer+blast/10__1007_slash_s40858___023___00584___7-50-15-24
Average 90 stars, based on 1 article reviews
ncbi primer blast online designing tool - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc ncbi online primer-design tool
Ncbi Online Primer Design Tool, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+online+primer+design+tool/ncbi+primer+design+tool/10__1016_slash_j__cj__2021__10__003-78-15-17
Average 90 stars, based on 1 article reviews
ncbi online primer-design tool - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc ncbi primer-design online tool
Ncbi Primer Design Online Tool, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+online+primer+design+tool/ncbi+primer+design+tool/10__21931_slash_rb_slash_2022__07__01__31-52-9-10
Average 90 stars, based on 1 article reviews
ncbi primer-design online tool - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Elim Bio ncbi online primer-designing tool
Ncbi Online Primer Designing Tool, supplied by Elim Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ncbi+online+primer+design+tool/ncbi+online+primer+designing+tool/pmc03912856-572-5-15
Average 90 stars, based on 1 article reviews
ncbi online primer-designing tool - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results